Research - Clinical Schizophrenia & Related Psychoses ( 2021) Volume 0, Issue 0
Association of ROS Level with Some DNA Repair Genes Polymorphisms in Type 1 Diabetes Mellitus Patients
Mona N. Al-Terehi1*, Hadeel Alaa Al-Rrubaei2 and Noora M. Hameed32Deparment of DNA Research Center, University of Babylon, Hillah, Iraq
3Department of Anesthesia Technique, Al-Nisour University College, Baghdad, Iraq
Mona N. Al-Terehi, College of Science, University of Babylon, Hillah, Iraq, Email: Monanajah1981@gmail.com
Received: 19-Jul-2021 Accepted Date: Aug 02, 2021 ; Published: 09-Aug-2021
Abstract
The ROS is most problems in some disease and have major role disease development; DNA repair genes have been associated with different disease in addition to related with ROS, the present study aims to study ROS level with some DNA repair genes polymorphisms in patient with type 1 diabetes mellitus patients, the OGG1 Ser326Cys (rs1052133) and APE1 Asp148Glu (rs3136820), the results show that ROS level was significant elevation in patients 196.3600 ± 90.039 than control 95.37 ± 13.22, the genotyping of APE1 shows three genotyping (GT,GG and TT) with tow alleles (G and T), GT was low frequents in patients while TT was higher in patients than control in non-significant differences (p 0.38, 0.50) , T is more frequent in patients in addition to G was low frequent also in on significant differences (p 0.0513 ) in addition to deletion mutation which significant association with disease, OGG1 show strong association with disease, all patients have AC pattern which contributed in lowering ROS level, the present study concluded that the APE1 deletion mutation association with DM and didn’t relation with ROS level, OGG1 SER326CYS (RS1052133) strong association with DM and ROS level in type one of diabetes mellitus diseases.
Keywords
ROS • DNA repair genes • Polymorphisms • Type 1 diabetes mellitus • Nucleic acids • Patients • Diabetes • Mellitus
Introduction
The Reactive Oxygen Species (ROS) is a free radicals produced naturally in cells for involved in the some cell functions, the excessive ROS have been recorded that it’s related with disease incidence and developments [1]. Diabetes mellitus found to be associated with oxidative stress imbalance and elevation of ROS, and pivotal role in DM complications [2], the excessive ROS production targeted biological molecules like proteins, nucleic acids and lipids [3].
The oxidative stress balanced in the body dependent on different factors like antioxidant capacity molecules, the stress exposure period, repair system efficiency [4], the DNA repair genes is a system consist of different enzymes and proteins contributed in the oxidative nucleotides repair, the present study deal with APE1 (Apurinic/apyrimidinic endonuclease 1) and OGG1 (8-oxoguanine-DNA glycosylase 1) genes, both genes belong to base excision repair system which contributed in the rapier of oxidative DNA damage [5,6].
Diabetes Mellitus (DM) is one of the most important health problems in last decades in the world, the association between oxidative stress and diabetes mellitus have been proved [7]. The results of DNA damage is 8-oxo dG that is found in high percentages in DM patients [8]. Type 1 of diabetes mellitus characterized by insulin deficiency also recorded high percentages of ROS and the long periods of excessive free radicals exposure may be causes mutation in DNA repair genes [1].
Methodology
Type 1 diabetes mellitus patients attended to the Margan Hospital City were enrolled in present study, FBG, BMI, duration of disease, ROS were detection using classical lab tests, DNA was extracted from whole blood then APE1 Asp148Glu (rs3136820) polymorphism using PCR-CTTP 5′-CCT ACG GCA TAG GTG AGA CC; R1:5′-TCC TGA TCA TGC TCC TCC-3’;
F2: 5′-TCT GTT TCA TTT CTA TAG GCG AT; R2: 5′-GTC AAT TTC TTC ATG TGC CA. Three bands amplifying a 236 bp, 167 bp and a 360 bp band corresponded to the T allele, G allele and common band respectively. OGG1 SER326CYS (RS1052133) was amplified using PCR-SSCP [9,10]. OGG1 SER326CYS (RS1052133) F- GGTGGCCCTAAAGGACTCTC, R- AAGGTGCTTGGGGAATTTCT. Data were analysis using t test and odd ratio with CI95% at P value 0.05.
Results
The aim of this study was to study association ROS and tow DNA repair genes in diabetes mellitus type 1 patients, the results show the mean of ages were 49.2400 ± 12.650, 33.2414 ± 11.55 for patients and control, the BMI kg/m2 were 31.07 ± 6.346, 27.3407 ± 3.744 for patients and control, the fasting blood glucose was higher in patients 196.36 ± 90.0 than control 95.37 ± 13.224, also ROS higher in patients 196.3600 ± 90.039 than control 95.37 ± 13.22, all previous variables were significant differences between patients and control (Table 1).
| Categories | Control | DM type 1 | P value |
|---|---|---|---|
| Age | 33.2414 ± 11.55934 | 49.2400 ± 12.65003 | 0 |
| BMI kg/m2 | 27.3407 ± 3.74448 | 31.0764 ± 6.34624 | 0.01 |
| FBG | 95.3793 ± 13.22447 | 196.3600 ± 90.03975 | 0 |
| ROS | 25.8552 ± 7.74383 | 48.4042 ± 1.23339 | 0 |
Table 1: The statics analysis of age, BMI, FBG and ROS levels in study groups.
Tow DNA repair gene polymorphisms were studied in present research included APE1 and OGG1 SER326CYS (RS1052133), (Figure 1) show amplification products of PCR-CTTP of APE1 and PCR-SSCP of OOG1, the APE1 genotyping show that about 28% of patients were suffered from deletion mutation in this gene while 3.33% was observed in control group in significant differences (p 0.029), three genotyping (GT,GG and TT) were observed with tow alleles (G and T), GT was low frequents in patients while TT was higher in patients than control in non-significant differences (p 0.38, 0.50) , T is more frequent in patients in addition to G was low frequent also in on significant differences (p 0.0513 ) present finding pointed that deletion mutation was strong related with DM type 1 (Figure 1, Table 2).
| Genotyping | Patients | Control | Odd ratio | P value |
|---|---|---|---|---|
| Deletion | 7(28%) | 1(3.33%) | 11.2778 (1.2796 to 99.3984) | 0.0291 |
| GT | 3(12%) | 16(64% | 2.0513 (0.4110 to 10.2378) | 0.3811 |
| GG | 4(16%) | 5(20%) | ||
| TT | 11(44%) | 8(32%) | 1.7188 (0.3472 to 8.5081) | 0.5069 |
| G | 0.31 | 0.448 | 1.7806 (0.9967 to 3.1813) | 0.0513 |
| T | 0.69 | 0.551 |
Table 2: The APE 1 Asp148Glu (rs3136820) gene genotyping in study groups.
The OOG1 genotyping was explained in Figure 2 and Table 3, genotyping show three haplotypes, A, B, C in three patterns (ABC, AC and C), all patients have AC patterns while control groups show low frequent of AC and high frequent of ABC in significant differences (p 0.002, 0.001) the present results show strong association OGG1 SER326CYS (RS1052133) gene polymorphisms with DM type1.
| Haplotypes patterns | Patients | Control | Odd ratio | P value |
|---|---|---|---|---|
| ABC | 0 | 19(63%) | 86.4783 4.7955 to 1559.4807 | 0.0025 |
| AC | 25 (100%) | 2(6.66%) | ||
| C | 0 | 9(30%) | 193.8 8.5024 to 4417.3955 | 0.001 |
Table 3: The OGG 1 gene Haplotypes patterns in study group.
The association of APE1 and OGG genes polymorphisms with ROS was investigated in present study, the genotyping of APE 1 didn’t effect in the ROS level in patients and control (p 0.96, 0.89) but significant difference were observed between patient and control which have same genotyping (p 0.00, 0.00, 0.03 and 0.00) for deletion mutation, TT, GG, and TG respectively (Table 4), the OGG1 also didn’t effect in ROS level because of one heliotyping was appeared in present study, significant elevation observed in patients than control which have AC patterns.
| Genotyping | Control | Patients | P value |
|---|---|---|---|
| APE1 Asp148Glu (rs3136820) | |||
| Deletion | 25.3200 ± 0.00 | 48.2291 ± 1.00846 | 0 |
| TT | 25.0588 ± 4.64372 | 48.4351 ± 1.48170 | 0 |
| GG | 31.7800 ± 13.25504 | 48.8375 ± 0.648 | 0.039 |
| TG | 24.3407 ± 6.60116 | 48.4133 ± 1.55577 | 0 |
| 0.898 | 0.966 | ||
| OGG1 SER326CYS (RS1052133) | |||
| ABC | 26.6083 ± 8.63134 | 0 | - |
| AC | 19.9150 ± .68589 | 48.4042 ± 1.23339 | 0 |
| C | 25.6689 ± 6.43240 | 0 | - |
| P value | 0.525 | - | |
Table 4: The impacts of APE1 and OGG 1 gene polymorphisms in the ROS levels in study groups.
Discussion
The diabetes mellitus is chronic disorder and most health problem in last decades on the world, its characterized by deficiency in insulin secretion or uptake by cells or both [11], investigation found that the elevation in free radicals was associated with DM, also decline in the antioxidant enzyme activity [12,13]. In present study free radicals levels were increased in type 1 of DM and this elevation may be because the hyperglycemic enhanced excessive free radicals production by four ways, first; increase the ratio between of rate G3P oxidation/1,3-DPG which resulted from glycolysis elevation, following by redox imbalance which resulted from increased NADH/NAD+ratio, second; accumulation the sorbitol and fructose by activation sorbitol pathway that lead to lowering in GSH and increased in the ration of NADH/NAD+, third; the glucose autoxidation causes production different types of free radicals, finally; formation of AGEs that upon interacting with RAGEs formation oxidative stress resulted from protein glycation [14].
The present study focused on the APE1 and OOG1 as a result of their role in the oxidative damage rapier of DNA, the previous studies pointed to APE1 gene polymorphism in some diseases like diabetes mellitus type 2, cancers types [15-17]. There were no previous information's about association APE1 with type 1 of DM, the relation of APE1 is associated with ROS elevation level Regardless of the type of disease, studies deal with APE1 gene polymorphisms in numerous diseases found elevation in ROS level because the activation of APE1 enzyme dependent on the ROS level [18,19]. Also it's related with mitochondrial stress [20]. The APE1 gene polymorphisms didn’t significant association with DM type1 but significant association with deletion mutation. In general the TT allele has been found to be associated with disease but in non-significant association.
The OGG1 SER326CYS (RS1052133) found to be strong association with DM type 1 disease, one Pattern (AC) with tow haplotypes (A,C) fond in disease while other pattern that fond in the control group didn't observe, the Ser326Cys is the more SNP was studied in investigations because it causes lowering enzyme function represented by helps in cleavage of the glycoside bond [21]. The OGG1 SER326CYS (RS1052133) polymorphisms play major role in some diseases pathogenesis like DM type 2 [18,22]. Other study elucidated no association with DM [23].
Conclusion
The Reactive Oxygen Species (ROS) is a free radicals produced naturally in cells for involved in the some cell functions, the excessive ROS have been recorded that it’s related with disease incidence and development. Diabetes mellitus found to be associated with oxidative stress imbalance and elevation of ROS, and pivotal role in DM complications, the excessive ROS production targeted biological molecules like proteins, nucleic acids and lipids.
The present study focused on the APE1 and OOG1 as a result of their role in the oxidative damage rapier of DNA, the previous studies pointed to APE1 gene polymorphism in some diseases like diabetes mellitus type 2, cancers types. There were no previous information's about association APE1 with type 1 of DM, the relation of APE1 is associated with ROS elevation level Regardless of the type of disease, studies deal with APE1 gene polymorphisms in numerous diseases found elevation in ROS level because the activation of APE1 enzyme dependent on the ROS level. Also it's related with mitochondrial stress. The APE1 gene polymorphisms didn’t significant association with DM type1 but significant association with deletion mutation. In general the TT allele has been found to be associated with disease but in non-significant association. The aim of this study was to study association ROS and tow DNA repair genes in diabetes mellitus type 1 patients, the results show the mean of ages were for patients and control, the BMI kg/m2 were for patients and control, the fasting blood glucose was higher in patients than control also ROS higher in patients than control, all previous variables were significant differences between patients and control. The diabetes mellitus is chronic disorder and most health problem in last decades on the world, its characterized by deficiency in insulin secretion or uptake by cells or both investigation found that the elevation in free radicals was associated with DM, also decline in the antioxidant enzyme activity.
References
- Phaniendra, Alugoju, Jestadi Dinesh Babu and Periyasamy Latha. “Free Radicals: Properties, Sources, Targets, and Their Implication in Various Diseases.” Indian J Clin Biochem 30 (2015): 11-26.
- Giacco, Ferdinando and Brownlee Michael. “Oxidative Stress and Diabetic Complications.” Circ Res 107 (2010): 1058-1070.
- Dröge, Wulf. “Free Radicals in the Physiological Control of Cell Function.” Physiol Rev 82 (2002): 47-95.
- Pizzino, Gabriele, Irrera Natasha, Cucinotta Mariapaola and Pallio Giovanni, et al. “Oxidative Stress: Harms and Benefits for Human Health.” Oxid Med Cell Longev 2017 (2017): 8416763.
- Zielinska, Agnieszka, Davies Owain T, Meldrum Rosalind A and Hodges Nikolas J. “Direct Visualization of Repair of Oxidative Damage by OGG1 in the Nuclei of Live Cells.” J Biochem Mol Toxicol 25 (2011): 1-7.
- Thakur, Shweta, Sarkar Bibekananda, Cholia Ravi P and Gautam Nandini, et al. “APE1/Ref-1 as an Emerging Therapeutic Target for Various Human Diseases: Phytochemical Modulation of its Functions.” Exp Mol Med 46 (2014): e106.
- Oguntibeju, Oluwafemi Omoniyi. “Type 2 Diabetes Mellitus, Oxidative Stress and Inflammation: Examining the Links.” Int J Physiol Pathophysiol Pharmacol 11 (2019): 45-63.
- Simone, Simona, Gorin Yves, Velagapudi Chakradhar and Abboud Hanna E, et al. “Mechanism of Oxidative DNA Damage In Diabetes: Tuberin Inactivation And Downregulation Of DNA Repair Enzyme 8-Oxo-7,8-Dihydro-2'-Deoxyguanosine-DNA Glycosylase.” Diabetes 57 (2008): 2626-2636.
- Al-Terehi, Mona, Hasan Aizhar Hamzih, AL-Jboory Methak J, Al-Saadi Ali H., et al. “Haplotype Polymorphisms in Cytokines Genes Using Pcr-Sscp Technique in Iraqi Breast Cancer Patients.” Der Pharma Chemica 8 (2016): 27-31.
- Alriyahee, Fulla Abd Alsattar, Hameed Noora M., Mohsen Israa Harjan and Al-Terehi Mona N. “Potential Impact of micro RNA-146a Gene Polymorphisms in Oxidative Stress of Diabetic Mellitus Type 1.” Sys Rev Pharm 11 (2020): 260-263.
- “Report of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus.” Diabetes Care 20 (1997): 1183-1197.
- Oberley, LW. “Free Radicals And Diabetes.” Free Radic Biol Med 5 (1988): 113-124.
- Bashan, Nava, Kovsan Julia, Kachko Ilana and Ovadia Hilla, et al. “Positive and Negative Regulation of Insulin Signaling by Reactive Oxygen and Nitrogen Species.” Physiol Rev 89 (2009): 27-71.
- Ahmed, RG. “The Physiological and Biochemical Effects of Diabetes on the Balance between Oxidative Stress and Antioxidant Defense System.” Med. J. Of Islamic Academy of Sci 15 (2005): 31-42.
- Jeon, Byeong Hwa, Gupta Gaurav, Park Young Chul and Qi Bing, et al. “Apurinic/Apyrimidinic Endonuclease 1 Regulates Endothelial No Production and Vascular Tone.” Circ Res 95 (2004): 902-910.
- Chen, Sumei, Xiong GuangSu, Wu Shuming and Mo Jianzhong. “Downregulation of Apurinic/Apyrimidinic Endonuclease 1/Redox Factor-1 Enhances the Sensitivity of Human Pancreatic Cancer Cells to Radiotherapy in Vitro.” Cancer Biother Radiopharm 28 (2013): 169-176.
- Das, Sambuddha, Purkayastha Sukanya, Roy Hirakjyoti and Sinha Anima, et al. “Polymorphisms in DNA Repair Genes Increase the Risk for Type 2 Diabetes Mellitus and Hypertension.” Biomol Concepts 9 (2018): 80-93.
- Pines, Alex, Perrone Lorena, Bivi Nicoletta and Romanello Milena, et al. “Activation of APE1/Ref-1 is Dependent on Reactive Oxygen Species Generated after Purinergic Receptor Stimulation by ATP.” Nucleic Acids Res 33 (2005): 4379-4394.
- Ramana, Chilakamarti V., Boldogh Istvan, Izumi Tadahide, and Mitra Sankar. “Activation of Apurinic/Apyrimidinic Endonuclease in Human Cells by Reactive Oxygen Species and its Correlation with their Adaptive Response to Genotoxicity of Free Radicals.” PNAS 95 (1998): 5061-5066.
- Barchiesi, Arianna, Bazzani Veronica, Tolotto Vanessa and Elancheliyan Praveenraj, et al. “Mitochondrial Oxidative Stress Induces Rapid Intermembrane Space/Matrix Translocation of Apurinic/Apyrimidinic Endonuclease 1 Protein through TIM23 Complex.” J Mol Biol 432 (2020): 166713.
- Das, Sambuddha, Nath Sayantan, Bhowmik Aditi and Ghosh Sankar Kumar, et al. “Association between OGG1 Ser326Cys Polymorphism and Risk of Upper Aero-Digestive Tract and Gastrointestinal Cancers: a meta-analysis.” Springerplus 5 (2016): 227.
- Thameem, Farook, Puppala Sobha, Lehman Donna M and Stern Michael P, et al. “The Ser(326)Cys Polymorphism of 8-Oxoguanine Glycosylase 1 (OGG1) is Associated with Type 2 Diabetes in Mexican Americans.” Hum Hered 70 (2010): 97-101.
- Kasznicki, Jacek, Krupa Renata, BÅ?asiak Janusz and Drzewoski Józef. “Association between Polymorphisms of the DNA Repair Genes XRCC1 and Hogg1 and Type 2 Diabetes Mellitus in the Polish Population.” Pol Arch Med Wewn 119 (2009): 122-128.
Citation: Al-Terehi, Mona N, Hadeel Alaa Al-Rrubaei and Noora M. Hameed. "Association of ROS Level with Some DNA Repair Genes Polymorphisms in Type 1 Diabetes Mellitus Patients.” Clin Schizophr Relat Psychoses 15S(2021). Doi:10.3371/CSRP.AMAH.080921.
Copyright: © 2021 Al-Terehi MN, et al. This is an open-access article distributed under the terms of the creative commons attribution license which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN: 1935-1232 (P)




