Brief Report - Clinical Schizophrenia & Related Psychoses ( 2021) Volume 0, Issue 0
Association Of 8Oxo2Deoxyguanosine Hogg1 Ser326Cys Gene Polymorphism With Reactive Oxygen Species In Depression Patients
Mona N Al‐Terehi1*, Abed J Kadhim2, Israa Harjan Mohsen3, Marwa Fadhil Alsaffar4, Shakir Atiyah5, Saif Yaseen Hasan6, Doaa A Hamad3, Ghadeer Sabah Bustani7, Saif Aldeen Muhannad Abdullah8 and Rehab Subhi Ramadhan92Department of Science, Al‐Nisour University, Baghdad, Iraq
3Department of Nursing, University of Babylon, Hillah, Iraq
4Department of Medical Laboratory, AL‐Mustaqbal University, Hillah, Iraq
5Department of Science, Al‐Manara College, Maysan, Iraq
6Department of Science, National University of Science and Technology, Dhi‐Qar, Iraq
7Department of Science, Islamic University, Najaf, Iraq
8Department of Medical Laboratory Technics, Al‐Zahrawi University College, Karbala, Iraq
9Department of Science, Al‐Esraa University, Baghdad, Iraq
Mona N Al‐Terehi, Department of Science, Babylon University, Hillah, Iraq, Email: monanajah1981@gmail.com
Received: 05-Nov-2021 Accepted Date: Nov 19, 2021 ; Published: 26-Nov-2021, DOI: 10.3371/CSRP.AMAK.261121
Abstract
The present work was suggested to study the relation 8-Oxo-2'-deoxyguanosine (8-oxo-dG) with ROS level and hOGG1 gene polymorphism in depression disorder patients, blood samples were collected from study groups to estimate ROS and 8-oxo-dG in addition to DNA extraction to detection hOGG1 Ser326Cys polymorphism using SSCP technique, The results show that there was non-significant in 8-oxo-dG level (P=0.174) and significant differences (P=0.174) in ROS level in study groups, The correlation coefficient between ROS and 8-oxo-dG in shows weak positive correlation in patients group (r-0.188, P 0.426) and nonsignificant weak invers corelation in control group (r-0.074, P 0.719), the target sequence of hOGG gene was amplified to produced 290 pb and genotyping shows three patterns include (3,2 and single haplotype). The pattern of 3 haplotypes didn't observed in patients while appeared in high percentage of control (61.535%) in significant differences (P=0.0046), the 2 haplotypes pattern was more frequent in patient (73.68%) than control group (7.69%) in significant differences (P 0.010), the single haplotypes was recorded in low percentage in patients (26.31%) than control group (30.76%),The impact of hOGG1 gene polymorphisms in the 8-oxodG and ROS levels show non-significant differences among haplotypes, the 2 haplotypes causes elevation in the 8-oxo-dG in patients while causes decrement in control group, the single haplotypes causes decreasing in the 8-oxo-dG in patients than control group and finally slightly differences were observed in ROS level among haplotypes in study groups. From present study can be concluded the 8-oxo-dG and ROS were strong related with depression and strong associated with OGG1 Ser326Cys gene polymorphism.
Keywords
ROS level • DNA damage • Disorder
Introduction
The Depression is a multifactorial disorder causes by interaction different factors such as genetics, psychological, environmental, and biological factors, the unbalanced of neurotransmitters metabolism have role in depression etiology [1,2].
The depression disorder is one of the big health problem in the world that has a lifetime prevalence of 12% [3], and it's related to the suicides that are as much as 16 per 100,000 [4].
Oxidative stress produced by unbalanced between free radicals production and antioxidant molecules, the free radicals is a by-products of oxidative phosphorylation in mitochondria which included reactive oxygen species and reactive nitrogen species [5], the free electron in free radical can be contributed in tissue damage, lipids and proteins in addition to DNA damage [6,7]. The oxidative stress become one of the important factor contributed in different disease incidence such as neuropsychiatric diseases like Depression [8], the effect of ROS in etiology of DD have been found by various mechanisms included inflammation, autoimmune processes such as tissue damage by apoptosis and neurodegeneration [9-11].
The DNA damage is caused by exposure to different molecules that lead to structural alteration in DNA strands and different mutations types; 8-oxo-dG is an oxidized derivative of de-oxy guanine in DNA exposed to oxidation molecules and its concentration used as indicators of DNA oxidation [12-16]. The hOGG is gene encodes glycosylase that recognizes and removes oxidative modified DNA bases, it regulates the excision and removal of 8-OH-dG adducts through the base excision repair pathway, the hOGG1 (rs1052133 C>G) SNP may influence the DNA repair capacity as the mutant genotype has a reduced protein activity [17]. Belong to main role in DNA repair its enrolled in present study in addition to detect DNA damage by measured 8-oxo-dG and its relation with ROS level in DD.
Methodology
Study design
A 20 depression disorders cases were enrolled with 25 healthy individuals in present study, samples were collected to DNA extraction and serum isolated for ROS detected.
Biomarkers: ROS and 8- Human 8-Hydroxyguanine were detected using colorimetric for ROS and ELIZA kit (E3867Hu) provided from bioassay technology Lab.
DNA extraction: The DNA extracted from whole blood using favor gene extraction kit with high concentration and purity.
Amplification conditions and target sequences; the hOGG1 Ser326Cys was targeted in present study using the following primers F- GGTGGCCCTAAAGGACTCTC, R- AAGGTGCTTGGGGAATTTCT to amplified 295 bp [18]. Then amplification product analyzed using single strand conformation polymorphism to detection the haplotypes [19].
SSCP technique
40% of acrylamide-bis-acrylamide was used with glycerol, TBE (5X) dH2O, TEMD and ammonium-per sulfate were used to preparation gel, the samples were denatured with loading dye (formamid, xylene cyanol, bromophenol blue and EDTA) 1:1 V/V under 95 for 7 min the chilled in ice for 2 min before applied in gel, after samples applied in gel 100 V with 0.5X of TBE used to electrophoresis gel for 40 min, finally gel was staining by ethidum bromide and visualized under UV documentation.
Results
The results show that there was non-significant in Patients group in 8-oxo-dG level (P=0.174) and significant differences (P=0.000) in ROS (Figure 1).
The correlation coefficient between ROS and 8-oxo-dG in patients and control shows weak positive correlation in patients group (r-0.188, P 0.426) and non-significant weak invers corelation in control group (r-0.074, P 0.719) (Figure 2).
The DNA extracted from whole blood shoes in Figure 3A and the target sequence of hOGG gene was amplified to produced 290 pb (Figure 3B), the hOGG1 genotyping was studied using haplotype by SSCP technique , the output shows three patterns include (3,2 and single haplotype (Figure 3C).
The pattern of 3 haplotypes didn't observed in patients while appeared in high percentage of control (61.535) in significant differences (P 0.0046), the 2 haplotypes pattern was more frequent in patient (73.68%) than control group (7.69%) in significant differences (P 0.010), the single haplotypes was recorded in low percentage in patients (26.31%) than control group (30.76%) (Table 1).
| Haplotypes patterns | Patients (%) | Control (%) | Odd ratio | P value |
|---|---|---|---|---|
| 3 haplotypes | 0 (0%) | 16(61.53%) | 67.7368 3.65 - 1253.99 |
0.0046 |
| 2 haplotypes | 14(73.68%) | 2(7.69%) | 11.2000 1.75 - 71.63 |
0.0107 |
| Single haplotypes | 5(26.31%) | 8(30.76%) |
The impact of hOGG1 gene polymorphisms in the 8-oxo-dG and ROS levels were investigated, there was non-significant differences among haplotypes, the 2 haplotypes causes elevation in the 8-oxo-dG in patients (31.05 ± 5.48) while causes decrement in control group (12.98 ± 0.65), the single haplotypes causes decreasing in the 8-oxo-dG in patients (15.73 ± 4.01) and control group (19.77 ± 3.59). Slightly differences were observed in ROS level among haplotypes in study groups (Table 2).
| Haplotypes patterns | Patients 8-oxo-dG |
Patient ROS |
Control 8-oxo-dG |
Control ROS |
|---|---|---|---|---|
| 3 haplotypes | 0 | 0 | 21.58 ± 5.25 | 27.26 ± 2.23 |
| 2 haplotypes | 31.05 ± 5.48 | 107.93 ± 14.15 | 12.98 ± 0.65 | 24.97 ± 4.57 |
| Single haplotypes | 15.73 ± 4.01 | 109.55 ± 30.12 | 19.77 ± 3.59 | 26.14 ± 2.37 |
| sig | 0.130 | 0.957 | 0.132 | 0.998 |
Discussion
Present study focusing on the DNA damage represented by 8-oxo-dG and it's related with ROS and hOGG1 gene polymorphism, the results show non-significant elevation in 8-oxo-dG and significant elevation in ROS in patients group, the 8-oxo-dG is generated by DNA exposure to free radicals and this proved by ROS high level in patients, other study pointed that there was high level of 8-oxo-dG in urine of Patients with depression and proved by some studies in different samples like leukocyte serum, plasma whole and urine the increased 8-oxo-dG in DNA led to accumulation mutations that led to development other disease in depression disorders patients [14,20-22]. Furthermore other investigation suggested using 8-oxo-dG as biological markers of diagnosis, state and treatment response in bipolar disorder. The correlation in patients was weak positive relation between 8-oxo-dG and ROS while weak invers relation observed in control group; this changes in correlations clarified the association ROS and 8-oxo-dG with depression disorders patients in Iraqi population.
The hOGG1 Ser326Cys haplotypes were studied in present study using SSCP technique, strong association between haplotypes and depression patients, the hOGG gene encodes to glycosylase that recognizes and removes oxidative modified DNA bases [23]. A study conducted by Czarny et al, found that there were association between the c.977C4G in hOGG and mental diseases with limited impact on the risk of depression disorder recurrent type occurrence, the genotype C/C at the .977C4G–hOGG1 (rs1052133) site together with others genetics factors may significantly decrease this risk. The study concluded that there was association between depression with ROS, 8-oxo-Dg and haplotypes of hOGG gene at SNP rs1052133.
Conclusion
The current results concluded that there was a strong association between DD and ROS, but didn’t lead to increment DNA damage represented by the level of 8-oxo-dg. The impact of hOGG1 gene polymorphisms in the 8-oxo-dG and ROS levels show non-significant differences among haplotypes, the 2 haplotypes causes elevation in the 8-oxo-dG in patients while causes decrement in control group, the haplotypes of hOGG gene at SNP rs1052133 was strong association with DD and didn’t affect in the level of ROS and 8-oxo-dg.
References
- Lopresti, Adrian L, Sean D Hood and Peter D Drummond. “A Review of Lifestyle Factors that Contribute to Important Pathways Associated with Major Depression: Diet, Sleep and Exercise.” J Affect Disord 148 (2013): 12-27.
- Caballero-Martinez, Fernando, Fernando Leon-Vazquez, Alfredo Paya-Pardo, and Antonio Diaz-Holgado. "Use of Health Care Resources and Loss of Productivity in Patients with Depressive Disorders Seen in Primary Care: INTERDEP Study.” Actas espanolas de psiquiatria 42 (2014): 281-291.
- Andrade, Laura, Jorge J Caraveoâ?Anduaga, Patricia Berglund and Rob V Bijl, et al. “The Epidemiology of Major Depressive Episodes: Results from the International Consortium of Psychiatric Epidemiology (ICPE) Surveys.” Int J Methods Psychiatr Res 12 (2003): 3-21.
- World Health Organization. Suicide Prevention. Geneva: World Health Organization, Switzerland, (2013).
- Pero RW, Roush GC, Markowitz MM and Miller DG. “Oxidative Stress, DNA Repair, and Cancer Susceptibility.” Cancer Detect Rev 14 (1990):555–561.
- Davies KJ. “Oxidative Stress: The Paradox of Aerobic Life.” Biochem Soc Symp 61 (1995): 1–31.
- Halliwell, Barry. “Biochemistry of Oxidative Stress.” Biochem Soc Trans 35 (2007): 1147-1150.
- Bajpai, Ashutosh, Akhilesh Kumar Verma, Mona Srivastava and Ragini Srivastava. “Oxidative Stress and Major Depression.” J Clin Diagn Res 8 (2014): CC04.
- Maes, Michael, Piotr Galecki, Yong Seun Chang and Michael Berk. “A Review on the Oxidative and Nitrosative Stress (O&NS) Pathways in Major Depression and their Possible Contribution to the (neuro) Degenerative Processes in that Illness.” Prog Neuropsychopharmacol Biol Psychiatry 35 (2011): 676-692.
- Maes, Michael, Raz Yirmyia, Jens Noraberg and Stefan Brene, et al. “The Inflammatory and Neurodegenerative (I&ND) Hypothesis of Depression: Leads for Future Research and New Drug Developments in Depression.” Metab Brain Dis 24 (2009): 27-53.
- Stockmeier, Craig A, Gouri J Mahajan, Lisa C Konick and James C Overholser, et al. “Cellular Changes in the Postmortem Hippocampus in major Depression.” Biol Psychiatry 56 (2004): 640-650.
- de Souza-Pinto, Nadja C, Lars Eide, Barbara A Hogue and Tanja Thybo, et al. “Repair of 8-Oxodeoxyguanosine Lesions in Mitochondrial DNA Depends on the Oxoguanine DNA Glycosylase (OGG1) Gene and 8-Oxoguanine Accumulates in the Mitochondrial DNA of OGG1-Defective Mice.” Cancer Res 61 (2001): 5378-5381.
- Raghda SM Al-Omari and Mahdi H Al-Ammar. “Association between TNF-α (-308G →A) Gene Polymorphism and Burn Patient with Sepsis”. Int J Drug Delivery Technology 11 (2021): 217-221.
- Alsadawi, A Aqeel, Jaleel Duabel and Alnaji, Haider A. “Hepatitis C and il-6 with 174G/C Gene Polymorphism in β-Thalassemia.” Int J of Drug Delivery Technol 9 (2019): pp. 617-622.
- Kirtipal, N, Sobti, RC, Thakur H and Janmeja, AK. Association of il 10 Gene Polymorphism with Chronic Obstructive Pulmonary Disease in a North Indian Population .” Bioche Cellular Arch 11 (2011): 41-47.
- Kadhem, Esraa J and M Darweesh. “Association of IL-101082G/A Gene Polymorphism with its Serum Levels in Asthma Patients.” Biochem Cell Arch 17 (2017): 709-713.
- Hill, Jeff W and Michele K Evans. “Dimerization and Opposite Base-Dependent Catalytic Impairment of Polymorphic S326C OGG1 Glycosylase.” Nuc Acid Res 34 (2006): 1620-1632.
- Das, Sambuddha, Sukanya Purkayastha, Hirakjyoti Roy and Anima Sinha, et al. “Polymorphisms in DNA Repair Genes Increase the Risk for Type 2 Diabetes Mellitus and Hypertension.” Biomol Concepts 9 (2018): 80-93.
- Alsattar Alriyahee, Fulla Abd, Noora M Hameed and Israa Harjan Mohsen et al. “Potential Impact of Micro RNA-146a Gene Polym orphisms in Oxidative Stress of Diabetic Mellitus Type 1.” Sys Rev in Phar 11 (2020): 260-263.
- Ceylan, Deniz, Selda Yılmaz, Gamze Tuna, Melis Kant and AyÅ?e Er, et al. “Alterations in Levels of 8-Oxo-2'-Deoxyguanosine and 8-Oxoguanine DNA Glycosylase 1 During a Current Episode and After Remission in Unipolar and Bipolar Depression.” Psychoneuroendocrinology 114 (2020): 104600.
- Czarny, Piotr, Dominik Kwiatkowski, Piotr Galecki and Monika Talarowska, et al. “Association between Single Nucleotide Polymorphisms of MUTYH, hOGG1 and NEIL1 Genes, and Depression.” J Affect Disord 184 (2015): 90-96.
- Forlenza, Michael J and Gregory E Miller. “Increased Serum Levels of 8-hydroxy-2′-Deoxyguanosine in Clinical Depression.” Psychosomatic Med 68 (2006): 1-7.
- Bjørås, Magnar, Luisa Luna, Barbro Johnsen and Elsebeth Hoff, et al. “Opposite Base-Dependent Reactions of a Human base Excision Repair Enzyme on DNA Containing 7, 8-Dihydro-8-Oxoguanine and Basic Sites.” EMBO J 16 (1997): 6314-6322.
Citation: Al‐Terehi, Mona N, Abed J Kadhim, Israa Harjan Mohsen and Marwa Fadhil Alsaffar, et al. “Association of 8-Oxo-2'- Deoxyguanosine, hOGG1 Ser326Cys Gene Polymorphism with Reactive Oxygen Species in Depression Patients.” Clin Schizophr Relat Psychoses 15S (2021). Doi: 10.3371/CSRP.AMAK.261121.
Copyright: © 2021 Al‐Terehi MN et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN: 1935-1232 (P)





